Stem-loop sequence aca-mir-98

AccessionMI0018893 (change log)
DescriptionAnolis carolinensis miR-98 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ccauuua    u       u                 u    ---------       g g 
5'        cuuc guugggg gagguaguaaguuguau guug         uggggua g a
          |||| ||||||| ||||||||||||||||| ||||         ||||||| |  
3'        gggg caauccc uuucaucauucaacaua caau         accccgu u u
   -------    u       -                 u    agagacuaa       g u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 205025683-205025789 [-]
sense
ENSACAT00000004565 ; HUWE1-201; intron 58
Clustered miRNAs
< 10kb from aca-mir-98
aca-let-7f-1chr1: 205026170-205026253 [-]
aca-mir-98chr1: 205025683-205025789 [-]
Database links

Mature sequence aca-miR-98-5p

Accession MIMAT0021994
Previous IDsaca-miR-98
Sequence

20 - 

ugagguaguaaguuguauugu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-98-3p

Accession MIMAT0021995
Previous IDsaca-miR-98*
Sequence

78 - 

uauacaacuuacuacuuucc

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).