Stem-loop sequence ath-MIR5657

AccessionMI0019241 (change log)
DescriptionArabidopsis thaliana miR5657 stem-loop
Stem-loop
   ---   aaua      g   u       ----u aa     ga  cc 
5'    cca    cgaguc aac cuugucc     g  gugua  gg  u
      |||    |||||| ||| |||||||     |  |||||  ||   
3'    ggu    guuuag uug gaacagg     c  cacau  cc  a
   aaa   ---g      a   -       ucaac aa     ga  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 9789582-9789666 [+]
intergenic
Database links

Mature sequence ath-miR5657

Accession MIMAT0022430
Sequence

61 - 

uggacaagguuagauuuggug

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).