Stem-loop sequence gma-MIR5668

AccessionMI0019262 (change log)
DescriptionGlycine max miR5668 stem-loop
Literature search

1 open access papers mention gma-MIR5668
(1 sentences)

Stem-loop
   gga    -   g  aug       c  uuu      --------         cu acauuu 
5'    ugcu uug ag   uuguaau cc   uuguug        gaaguuucu  c      u
      |||| ||| ||   ||||||| ||   ||||||        |||||||||  |       
3'    acga agc uc   gauauua gg   aacgac        cuucggaga  g      c
   uga    c   g  --a       a  --u      ugguaaaa         ac aaagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 29347569-29347681 [+]
intergenic
Database links

Mature sequence gma-miR5668

Accession MIMAT0022450
Sequence

83 - 

agcaauggaauuauagacugc

 - 103

Get sequence
Evidence experimental; Illumina [1], RT-PCR [1]

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).