Stem-loop sequence gma-MIR1512c

AccessionMI0019270 (change log)
DescriptionGlycine max miR1512c stem-loop
Gene family MIPF0001291; MIR1512
Literature search

12 open access papers mention gma-MIR1512c
(26 sentences)

Stem-loop
   uc     a c        c             ca     guag    a    a 
5'   uugau c uaacugaa auucuuagagcau  ccauu    uuca cauc u
     ||||| | |||||||| |||||||||||||  |||||    |||| |||| a
3'   aacua g auugacuu uaagaauuucgua  gguaa    aagu guag a
   cu     c u        -             ag     ---a    -    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 8698923-8699026 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR1512c
gma-MIR1512bchr2: 8707970-8708058 [-]
gma-MIR1512cchr2: 8698923-8699026 [-]
Database links

Mature sequence gma-miR1512c

Accession MIMAT0022458
Sequence

11 - 

uaacugaacauucuuagagcau

 - 32

Get sequence
Evidence experimental; Illumina [1-2], RT-PCR [1]

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).