Stem-loop sequence gma-MIR530b

AccessionMI0019275 (change log)
DescriptionGlycine max miR530b stem-loop
Gene family MIPF0000521; MIR530
Literature search

3 open access papers mention gma-MIR530b
(4 sentences)

Stem-loop
   cuugua        uuu              -a    --      uucucuguaacauaaacaagagaaagugagg 
5'       uaucugca   gcaccugcacuuua  uuug  cuuggu                               a
         ||||||||   ||||||||||||||  ||||  ||||||                                
3'       guagacgu   cguggacguggaau  aaac  gaacca                               u
   ccguaa        cuc              gg    aa      gugaaaugaggauguauuuuauaaagaagag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 41761036-41761186 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR530b
gma-MIR530echr13: 41764574-41764770 [-]
gma-MIR530bchr13: 41761036-41761186 [-]
Database links

Mature sequence gma-miR530b

Accession MIMAT0022463
Sequence

11 - 

ugcauuugcaccugcacuuua

 - 31

Get sequence
Evidence experimental; Illumina [1-2], RT-PCR [1]

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).