Dead miRNA entry

miRNA accession:
MI0019583
miRNA ID:
dre-mir-187-2
Forward to:
MI0001370
Comment:
The sequences previously named mir-187-1 and mir-187-2 map to the same locus in the GRCz10 genome assembly. The entries are therefore merged.

Previous miRNA entry

Stem-loop sequence dre-mir-187-2

AccessionMI0019583 (change log)
DescriptionDanio rerio miR-187-2 stem-loop
Gene family MIPF0000078; mir-187
Stem-loop
   ugaccuguggcu gg   gg                  ----     c  u 
5'             g  cca  ggcugcaacacaggacau    gggag ug c
               |  |||  ||||||||||||||||||    ||||| || u
3'             c  ggu  ccgacguuguguucugug    cccuc ac c
   -----------g aa   ga                  cucg     -  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dre-miR-187

Accession MIMAT0001274
Sequence

61 - 

ucgugucuuguguugcagcc

 - 80

Get sequence
Evidence experimental; PCR [1], cloned [2]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).