Stem-loop sequence sha-mir-128

AccessionMI0019625 (change log)
DescriptionSarcophilus harrisii miR-128 stem-loop
Gene family MIPF0000048; mir-128
   uugucauuuaaccauguuuguuuaauaucauggaauaauu    uuauuu ug   u      uuc       uag      cu       u 
5'                                         ggcc      g  agc guugga   ggggccg   cacugu  gagaggu u
                                           ||||      |  ||| ||||||   |||||||   ||||||  |||||||  
3'                                         ucgg      c  ucg cgacuu   cucuggc   gugaca  cucuuua a
   -----------------------------cucauuuuucu    -----u cu   u      uuu       caa      --       c 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL849609.1: 2503876-2504025 [+]
ENSSHAT00000020198 ; R3HDM1-202; intron 15
ENSSHAT00000020197 ; R3HDM1-201; intron 17
Database links

Mature sequence sha-miR-128

Accession MIMAT0022798

101 - 


 - 121

Get sequence
Evidence experimental; Illumina [1]


PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).