Stem-loop sequence sha-mir-100

AccessionMI0019627 (change log)
DescriptionSarcophilus harrisii miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   -----------------------ca    a  -a      ----------g     -uu c    a   cg    uc   a      g  au 
5'                          agag ag  uucugg           gccug   g caca acc  uaga  cga cuugug ug  a
                            |||| ||  ||||||           |||||   | |||| |||  ||||  ||| |||||| ||   
3'                          ucuu uc  gggacc           cggac   c gugu ugg  aucu  guu gaacac ac  u
   aguuaccgaugcuucacgguauaug    g  cg      aaacacucuaa     ugu u    a   au    gu   c      -  cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL849656.1: 1017612-1017761 [+]
intergenic
Clustered miRNAs
< 10kb from sha-mir-100
sha-mir-100GL849656.1: 1017612-1017761 [+]
sha-let-7aGL849656.1: 1022775-1022924 [+]
Database links

Mature sequence sha-miR-100

Accession MIMAT0022800
Sequence

31 - 

aacccguagauccgaacuugu

 - 51

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).