Stem-loop sequence sha-let-7i

AccessionMI0019650 (change log)
DescriptionSarcophilus harrisii let-7i stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention sha-let-7i
(1 sentences)

Stem-loop
   ---------------ccgcuccagcguccgcaccauggcc     u                 u   --------  u     ugu 
5'                                         cuggc gagguaguaguuugugc guu        gg cgggu   g
                                           ||||| ||||||||||||||||| |||        || |||||   a
3'                                         gaucg uuccgucaucgaacgcg caa        uc gcccg   c
   ggcccgguaacagaagugggcgccgacuaguaguggucgu     -                 u   uagaggug  -     uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL861550.1: 1519507-1519656 [+]
intergenic
Database links

Mature sequence sha-let-7i

Accession MIMAT0022822
Sequence

31 - 

ugagguaguaguuugugcugu

 - 51

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).