Stem-loop sequence mtr-MIR171g

AccessionMI0019677 (change log)
DescriptionMedicago truncatula miR171g stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

8 open access papers mention mtr-MIR171g
(53 sentences)

Stem-loop
   gcuucagcu    --     u   u  c           c      a   auaucuucaaguucaauc 
5'          gcaa  aagua aca gg gugauauugau cggcuc ucu                  a
            ||||  ||||| ||| || ||||||||||| |||||| |||                  u
3'          cguu  uucgu ugu uc cacuauaacua gccgag aga                  c
   uuaauuaua    ac     u   -  u           a      c   cuuuaacuauacuuauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR171g

Accession MIMAT0023132
Sequence

91 - 

cgagccgaaucaauaucacuc

 - 111

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).