Stem-loop sequence mtr-MIR530

AccessionMI0019701 (change log)
DescriptionMedicago truncatula miR530 stem-loop
Gene family MIPF0000521; MIR530
Literature search

2 open access papers mention mtr-MIR530
(3 sentences)

Stem-loop
   a  u           u    c        -u    -  -  gcg   guaa     a  c    gaauu            au 
5'  gc uuuaucugcau ugca cugcacuu  cccu gg cu   ucu    cauau aa augu     aauuuguuuuau  a
    || ||||||||||| |||| ||||||||  |||| || ||   |||    ||||| || ||||     ||||||||||||  u
3'  cg aaguagacgua acgu gacgugga  ggga cc gg   agg    guaug uu uaua     uuaaauaaaaua  a
   c  u           u    a        uc    a  a  --a   ---a     a  -    -auau            aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
AC235487.1: 38438-38596 [-]
intergenic
Database links

Mature sequence mtr-miR530

Accession MIMAT0023156
Sequence

11 - 

ugcauuugcaccugcacuuuc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).