Stem-loop sequence gma-MIR5761a

AccessionMI0019702 (change log)
DescriptionGlycine max miR5761a stem-loop
Literature search

1 open access papers mention gma-MIR5761a
(1 sentences)

Stem-loop
   ga     -ag  u        aa  -       uuguuuagagauugccuucacaacaaauuuucuauugcauucuugauauguagacccuccucuga 
5'   uugga   ca gagcuuca  ac caagagg                                                                 u
     |||||   || ||||||||  || |||||||                                                                  
3'   aaccu   gu uucgaagu  ug guuuucc                                                                 g
   ag     aua  u        gc  u       cuuugaguuuaucuuguauuacaaaacuccaagguuguugguucaaaccuaguaguaauguuuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 51252115-51252310 [-]
intergenic
Database links

Mature sequence gma-miR5761a

Accession MIMAT0023157
Sequence

166 - 

uuuugugucgugaagcuuuug

 - 186

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).