Stem-loop sequence gma-MIR5767

AccessionMI0019709 (change log)
DescriptionGlycine max miR5767 stem-loop
Literature search

1 open access papers mention gma-MIR5767
(1 sentences)

Stem-loop
   -------------------------------ugggugc      a  -acc     a    caa      ac 
5'                                       ucuugg gg    uuuga ggug   uuugau  a
                                         |||||| ||    ||||| ||||   ||||||   
3'                                       agaauu cc    aaauu ccac   aggcua  c
   uccuagacaagggaacacaguugugauguuccagagac      a  acuc     a    ---      aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 30784546-30784656 [-]
intergenic
Database links

Mature sequence gma-miR5767

Accession MIMAT0023164
Sequence

11 - 

uggaggaccuuugaaggugca

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).