Stem-loop sequence gma-MIR5769

AccessionMI0019711 (change log)
DescriptionGlycine max miR5769 stem-loop
Literature search

1 open access papers mention gma-MIR5769
(1 sentences)

Stem-loop
   uuuau  c        g a     ga   g -      ugcauauagaguauuguacaggauuaaaaaaauaaauuuaauggca 
5'      cu cuucgucg c ucauu  cuu a cauauu                                              u
        || |||||||| | |||||  ||| | ||||||                                              u
3'      ga gaagcagc g aguaa  gga u guguaa                                              u
   aaacu  u        a a     ag   g a      uauaagggaaguaccagaauucaacuuaguacgaaaaccggcaacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 7386834-7387003 [+]
intergenic
Database links

Mature sequence gma-miR5769

Accession MIMAT0023166
Sequence

140 - 

ugagggaaaugaagacgacga

 - 160

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).