Stem-loop sequence gma-MIR5770a

AccessionMI0019712 (change log)
DescriptionGlycine max miR5770a stem-loop
Gene family MIPF0001501; MIR5770
Literature search

3 open access papers mention gma-MIR5770a
(3 sentences)

Stem-loop
   -  -a                   u          ca u   c   agagaacaugcuaauugauuugugugcaccgcaaaaggggaauaagauuuucuaccuauggcgagguauaugucugu 
5'  gg  uauuucuuuaggacuaugg uuggacgagu  c acu agc                                                                             u
    ||  ||||||||||||||||||| ||||||||||  | ||| |||                                                                             g
3'  cc  guaaggaaauuuugauacc aaccuguuca  g uga uug                                                                             a
   c  aa                   u          cc u   c   agaagacacaauaguucgagacgugcuaaaaccugauuuucgacuuuuguuauuuucaauacucuuguauugguuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 46351571-46351817 [-]
intergenic
Database links

Mature sequence gma-miR5770a

Accession MIMAT0023167
Sequence

11 - 

uuaggacuaugguuuggacga

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).