Stem-loop sequence gma-MIR393b

AccessionMI0019715 (change log)
DescriptionGlycine max miR393b stem-loop
Gene family MIPF0000083; MIR393
Literature search

21 open access papers mention gma-MIR393b
(52 sentences)

Stem-loop
   a      gca           ca   u         uccaagcuucaauguucuucucu 
5'  gaggag   uccaaagggau  cau gaucccaaa                       c
    ||||||   |||||||||||  ||| |||||||||                       u
3'  cucuuc   agguuucccua  gua cuaggguuu                       u
   -      ---           uc   -         auuuuaauuauaaaacucacucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 42280842-42280957 [-]
intergenic
Database links

Mature sequence gma-miR393b

Accession MIMAT0023170
Sequence

86 - 

uuugggaucaugcuaucccuu

 - 106

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).