Stem-loop sequence gma-MIR4416c

AccessionMI0019717 (change log)
DescriptionGlycine max miR4416c stem-loop
Gene family MIPF0001389; MIR4416
Literature search

3 open access papers mention gma-MIR4416c
(4 sentences)

Stem-loop
   ----   uuuuu  g   u  c        ug        aa  a       aagaag  u  u gc         a   --u        gcugaac    cau 
5'     uca     cu ugg ca uucugcuc  ggugagag  ac cguauug      gu ca g  uuagacaau agu   gcuacuuu       ucac   u
       |||     || ||| || ||||||||  ||||||||  || |||||||      || || |  ||||||||| |||   ||||||||       ||||    
3'     agu     ga acc gu gggaugag  ccacucuc  ug gcauagc      ca gu c  aguuuguua ucg   cggugaag       agug   u
   aaau   --uuc  a   c  c        gu        gc  g       -augca  u  - uu         a   uau        ------a    uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 27334573-27334768 [-]
intergenic
Database links

Mature sequence gma-miR4416c-5p

Accession MIMAT0023172
Sequence

26 - 

cugggugagagaaacacguau

 - 46

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gma-miR4416c-3p

Accession MIMAT0037453
Sequence

151 - 

acgggucgcucucaccuggag

 - 171

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
2