Stem-loop sequence gma-MIR5761b

AccessionMI0019718 (change log)
DescriptionGlycine max miR5761b stem-loop
Literature search

1 open access papers mention gma-MIR5761b
(1 sentences)

Stem-loop
   g        c        cg  aa   u       cuaagaacccuagag 
5'  uuuuuuuu uuuugugu  ug  gcu uugaugc               c
    |||||||| ||||||||  ||  ||| |||||||               a
3'  aaaaaaaa aaaacacg  ac  cgg gauuaug               c
   a        a        -a  --   u       auguagauuauuaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 3831731-3831830 [+]
intergenic
Database links

Mature sequence gma-miR5761b

Accession MIMAT0023173
Sequence

11 - 

uuuugugucgugaagcuuuug

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).