Stem-loop sequence gma-MIR4416b

AccessionMI0019722 (change log)
DescriptionGlycine max miR4416b stem-loop
Gene family MIPF0001389; MIR4416
Literature search

4 open access papers mention gma-MIR4416b
(6 sentences)

Stem-loop
   au     a            aa  g         g   uucagggcuuacuaguucacacaguugcaucca 
5'   cuuug ucugggugagag  ac cguaucgau aga                                 c
     ||||| ||||||||||||  || ||||||||| |||                                 a
3'   gagau agauccacucuc  ug gcauagcua uuu                                 c
   uu     c            -c  g         g   ugugugagugagguuuaacaauuuuguuaacca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 36067834-36067977 [-]
intergenic
Database links

Mature sequence gma-miR4416b

Accession MIMAT0023177
Sequence

11 - 

ugggugagagaaacgcguauc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).