Stem-loop sequence gma-MIR5781

AccessionMI0019731 (change log)
DescriptionGlycine max miR5781 stem-loop
Literature search

1 open access papers mention gma-MIR5781
(1 sentences)

Stem-loop
   ccaa     ggc     ag     g g    cuug ga    a 
5'     cuuca   ucagg  gcagu u aguu    u  uugc u
       |||||   |||||  ||||| | ||||    |  ||||  
3'     gaagu   ggucu  cguca a ucaa    g  agcg c
   auag     --a     -a     g g    ---a uc    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 36774683-36774764 [-]
intergenic
Database links

Mature sequence gma-miR5781

Accession MIMAT0023186
Sequence

51 - 

cugaaacugagacugcaucugg

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).