Stem-loop sequence gma-MIR5770b

AccessionMI0019734 (change log)
DescriptionGlycine max miR5770b stem-loop
Gene family MIPF0001501; MIR5770
Literature search

2 open access papers mention gma-MIR5770b
(2 sentences)

Stem-loop
   -  -a                   u          cacuacucagagcacaaaacaugcuaauuaauuugugugcacuggaauguucucuaccuaucuaucgugagcuauauaucucuuugguuauguuc 
5'  gg  uauuucuuuaggacuaugg uuggacaagu                                                                                               u
    ||  ||||||||||||||||||| ||||||||||                                                                                               c
3'  cc  guaaggaaauuuugauacc aaccuguuca                                                                                               a
   c  aa                   u          ccguugacuugagaagacagugauguuacacaauaguuggagacguccuaaaaccugaucuucgaccaguucuaaugaacguuuuugucuucaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 16812503-16812763 [-]
intergenic
Database links

Mature sequence gma-miR5770b

Accession MIMAT0023189
Sequence

11 - 

uuaggacuaugguuuggacaa

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).