Stem-loop sequence gma-MIR828a

AccessionMI0019740 (change log)
DescriptionGlycine max miR828a stem-loop
Gene family MIPF0000544; MIR828
Literature search

8 open access papers mention gma-MIR828a
(21 sentences)

Stem-loop
   uug       u    c            uc  a  -acaguc   uu      gaa 
5'    uaauguu cuug ucaaaugaguau  ca cc       aca  uggcau   u
      ||||||| |||| ||||||||||||  || ||       |||  ||||||   a
3'    auuguaa gaac aguuuacucgua  gu gg       ugu  accgug   u
   aaa       c    c            ga  a  aaacucc   -c      ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr11: 9052348-9052460 [+]
intergenic
Database links

Mature sequence gma-miR828a

Accession MIMAT0023195
Sequence

11 - 

ucuugcucaaaugaguauucca

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).