Stem-loop sequence gma-MIR530c

AccessionMI0019742 (change log)
DescriptionGlycine max miR530c stem-loop
Gene family MIPF0000521; MIR530
Literature search

3 open access papers mention gma-MIR530c
(4 sentences)

Stem-loop
   ----uucguu    u   cug c  ug      uu              --a        u   u     --acuacua g         cacaaaagcaugucaaug 
5'           ccaa aug   c uu  ccugca  ugcaccugcacuuu   cuugguuu cuc guuca         a acguacuac                  g
             |||| |||   | ||  ||||||  ||||||||||||||   |||||||| ||| |||||         | |||||||||                  a
3'           gguu uac   g aa  ggacgu  acguggacguggag   gaaccaaa gag caggu         u uguaugaug                  g
   auauauauuc    c   --a u  gu      cu              cac        -   -     aauuaagug g         cauuagaaaaauaaggaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr11: 26804548-26804754 [-]
intergenic
Database links

Mature sequence gma-miR530c

Accession MIMAT0023197
Sequence

26 - 

ugcauuugcaccugcacuuua

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).