Stem-loop sequence gma-MIR828b

AccessionMI0019743 (change log)
DescriptionGlycine max miR828b stem-loop
Gene family MIPF0000544; MIR828
Literature search

8 open access papers mention gma-MIR828b
(21 sentences)

Stem-loop
   uug       u                 uc  a  -aca uc   uu      ga 
5'    uaauguu cuugcucaaaugaguau  ca cc    g  aca  uggcau  a
      ||||||| |||||||||||||||||  || ||    |  |||  ||||||   
3'    auuguaa gaacgaguuuacucgua  gu gg    c  ugu  accgug  u
   aaa       c                 ga  c  aaac cc   -c      ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr12: 3219162-3219271 [+]
intergenic
Database links

Mature sequence gma-miR828b

Accession MIMAT0023198
Sequence

11 - 

ucuugcucaaaugaguauucca

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).