Stem-loop sequence gma-MIR530d

AccessionMI0019744 (change log)
DescriptionGlycine max miR530d stem-loop
Gene family MIPF0000521; MIR530
Literature search

3 open access papers mention gma-MIR530d
(4 sentences)

Stem-loop
   ----uucguu    u   cug c  ug      uu              --a        u   u     acaacuuagacguacgucuuaguugccacaaaagcauguc 
5'           ccaa aug   c uu  ccugca  ugcaccugcacuuu   cuugguuu cuc guuca                                        a
             |||| |||   | ||  ||||||  ||||||||||||||   |||||||| ||| |||||                                         
3'           gguu uac   g aa  ggacgu  acguggacguggag   gaaccaaa gag caggu                                        a
   uauauaaauc    c   --a u  gu      cu              cac        -   -     aauuaaggguguguauaauacauuagagaaaggaagaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr12: 6225432-6225643 [+]
intergenic
Database links

Mature sequence gma-miR530d

Accession MIMAT0023199
Sequence

26 - 

ugcauuugcaccugcacuuua

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).