Stem-loop sequence gma-MIR319n

AccessionMI0019752 (change log)
DescriptionGlycine max miR319n stem-loop
Gene family MIPF0001104; MIR319
Literature search

17 open access papers mention gma-MIR319n
(42 sentences)

Stem-loop
   ugugaaagcu c    au   a        g a c        cccu     a 
5'           g agaa  agg guucccuu c g ccaaaaca    gcaug a
             | ||||  ||| |||||||| | | ||||||||    ||||| c
3'           c ucuu  ucc cgagggaa g c gguuuugu    uguac u
   --------ca u    cu   c        - c a        ----     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 28262485-28262580 [-]
intergenic
Database links

Mature sequence gma-miR319n

Accession MIMAT0023207
Sequence

66 - 

uuuggaccgaagggagccccu

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).