Stem-loop sequence gma-MIR530e

AccessionMI0019754 (change log)
DescriptionGlycine max miR530e stem-loop
Gene family MIPF0000521; MIR530
Literature search

3 open access papers mention gma-MIR530e
(4 sentences)

Stem-loop
   -----u    g        uu  c          uu              aa  a   a  uu      -ga     ----a         ----a  aug        
5'       ugau ccgauaug  gc uuuaucugca  ugcaccugcacuuu  gu cuc gu  cucugu   cauau     aauaauaua     cu   ucaguug 
         |||| ||||||||  || ||||||||||  ||||||||||||||  || ||| ||  ||||||   |||||     |||||||||     ||   |||||| a
3'       auua gguuauac  cg aaguggacgu  acguggacguggag  ca gag ca  gagaua   guaua     uuauuauau     ga   agucagg 
   ccgguu    -        --  u          cu              --  a   c  gg      agg     auaua         aacua  -ga        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 41764574-41764770 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR530e
gma-MIR530echr13: 41764574-41764770 [-]
gma-MIR530bchr13: 41761036-41761186 [-]
Database links

Mature sequence gma-miR530e

Accession MIMAT0023209
Sequence

26 - 

ugcauuugcaccugcacuuua

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).