![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR169r |
||||||||
Accession | MI0019762 (change log) | |||||||
Description | Glycine max miR169r stem-loop | |||||||
Gene family | MIPF0001058; MIR169_6 | |||||||
Literature search |
![]()
23 open access papers mention gma-MIR169r | |||||||
Stem-loop |
a u a u - aaa aaaa 5' gaguagau ugagcc ggauggcu gccggcaua ugcuua gca g |||||||| |||||| |||||||| ||||||||| |||||| ||| a 3' cuuguuua acucgg ccuaccgg uggucguau augggu cgu u c u a - u --g cccc |
|||||||
Confidence |
Annotation confidence: not enough data
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence gma-miR169r |
|
Accession | MIMAT0023217 |
Sequence |
11 - ugagccaggauggcuugccggc - 32 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|