![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR396k |
|
Accession | MI0019764 (change log) |
Description | Glycine max miR396k stem-loop |
Gene family | MIPF0000047; MIR396 |
Literature search |
![]()
25 open access papers mention gma-MIR396k |
Stem-loop |
uuccucuc u ---- c a uau aucuuauaucucuc 5' aag ccug gucaug uuuuccacagcuuucuuga cuucu gc c ||| |||| |||||| ||||||||||||||||||| ||||| || a 3' uuc ggac cgguau agagggugucgaaagaacu gaaga cg c -guuaauu - uuaa a c ucc aauuuuacgaccuu |
Confidence |
Annotation confidence: not enough data
|
Database links |
|
Mature sequence gma-miR396k-5p |
|
Accession | MIMAT0032132 |
Sequence |
26 - uuccacagcuuucuugaacuu - 46 |
Evidence | experimental; Illumina [2] |
Mature sequence gma-miR396k-3p |
|
Accession | MIMAT0023219 |
Previous IDs | gma-miR396k |
Sequence |
94 - gcucaagaaagcugugggaga - 114 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|
2 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|