Stem-loop sequence gma-MIR2111b

AccessionMI0019765 (change log)
DescriptionGlycine max miR2111b stem-loop
Gene family MIPF0000754; MIR2111
Literature search

6 open access papers mention gma-MIR2111b
(31 sentences)

Stem-loop
   u     ca              ug   u     aa a   u 
5'  aggau  gguaaucugcaucc  agg uuaga  c aua g
    |||||  ||||||||||||||  ||| |||||  | |||  
3'  uccug  ccauuagauguagg  ucc aaucu  g uau u
   u     ca              gu   u     gg c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 45662001-45662084 [-]
intergenic
Database links

Mature sequence gma-miR2111b

Accession MIMAT0023220
Sequence

11 - 

uaaucugcauccugagguuua

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).