Stem-loop sequence gma-MIR2111d

AccessionMI0019769 (change log)
DescriptionGlycine max miR2111d stem-loop
Gene family MIPF0000754; MIR2111
Literature search

5 open access papers mention gma-MIR2111d
(28 sentences)

Stem-loop
   ---gaaugau      gucc   uu g             ug   u      -   uauc 
5'           ugcugg    gga  a guaaucugcaucc  agg uuagga caa    c
             ||||||    |||  | |||||||||||||  ||| |||||| |||    u
3'           acgacc    ccu  u cauuagacguagg  ucc gaucuu guu    u
   acaacauguc      -guu   uc g             gu   u      u   uugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gma-miR2111d

Accession MIMAT0023224
Sequence

73 - 

guccuugggaugcagauuacg

 - 93

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).