Stem-loop sequence gma-MIR399d

AccessionMI0019776 (change log)
DescriptionGlycine max miR399d stem-loop
Gene family MIPF0000015; MIR399
Literature search

14 open access papers mention gma-MIR399d
(92 sentences)

Stem-loop
   u   u c   a a         cu           accaacaagcua    -    u 
5'  ggg g auu c gggcaaguu  cuuuggcaggu            ugca auac a
    ||| | ||| | |||||||||  |||||||||||            |||| |||| u
3'  ucc c uaa g cccguuuag  gaaaccgucua            acgu ugug a
   -   u u   c a         ag           ------------    g    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr5: 35229349-35229451 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR399d
gma-MIR399echr5: 35238378-35238516 [-]
gma-MIR399dchr5: 35229349-35229451 [-]
gma-MIR399jchr5: 35222145-35222245 [+]
Database links

Mature sequence gma-miR399d

Accession MIMAT0023231
Sequence

73 - 

ugccaaaggagauuugcccag

 - 93

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).