Stem-loop sequence gma-MIR399e

AccessionMI0019777 (change log)
DescriptionGlycine max miR399e stem-loop
Gene family MIPF0000015; MIR399
Literature search

14 open access papers mention gma-MIR399e
(93 sentences)

Stem-loop
   guguggaucuucccaguugcagcugcauuaca        u    a         a  -  c  u  --ua    ucuca 
5'                                 gggcaagu cucc uuggcaggu gc ca ua ga    ugca     u
                                   |||||||| |||| ||||||||| || || || ||    ||||     a
3'                                 cccguuua gagg aaccgucua cg gu au cu    acgu     a
   --------------------uccucuuagcga        -    a         a  u  a  u  uuca    uuaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr5: 35238378-35238516 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR399e
gma-MIR399echr5: 35238378-35238516 [-]
gma-MIR399dchr5: 35229349-35229451 [-]
Database links

Mature sequence gma-miR399e

Accession MIMAT0023232
Sequence

109 - 

ugccaaaggagauuugcccag

 - 129

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).