![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR171t |
|||||
Accession | MI0019781 (change log) | ||||
Description | Glycine max miR171t stem-loop | ||||
Gene family | MIPF0000030; MIR171_1 | ||||
Literature search |
![]()
15 open access papers mention gma-MIR171t | ||||
Stem-loop |
gaagugcuguaugaagcacaaauca c u g - aaca 5' agguauuggcgcg cucaauu gaa u caugguu u ||||||||||||| ||||||| ||| | ||||||| g 3' ucuauaacugcgc gaguuaa uuu a guaccga a -------------uucacguucuac c u g u acaa |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR171t |
|
Accession | MIMAT0023236 |
Sequence |
87 - uugagccgcgucaauaucuca - 107 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|