Stem-loop sequence gma-MIR2111e

AccessionMI0019782 (change log)
DescriptionGlycine max miR2111e stem-loop
Gene family MIPF0000754; MIR2111
Literature search

5 open access papers mention gma-MIR2111e
(28 sentences)

Stem-loop
   u    uca              ug   u   gaaa a     u 
5'  agga   gguaaucugcaucc  agg uua    c auaug u
    ||||   ||||||||||||||  ||| |||    | |||||  
3'  uccu   ccauuagauguagg  ucc aau    g uauau u
   u    uca              gu   u   gggg c     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 16470310-16470397 [-]
intergenic
Database links

Mature sequence gma-miR2111e

Accession MIMAT0023237
Sequence

11 - 

uaaucugcauccugagguuua

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).