![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR2111e |
|||||
Accession | MI0019782 (change log) | ||||
Description | Glycine max miR2111e stem-loop | ||||
Gene family | MIPF0000754; MIR2111 | ||||
Literature search |
![]()
5 open access papers mention gma-MIR2111e | ||||
Stem-loop |
u uca ug u gaaa a u 5' agga gguaaucugcaucc agg uua c auaug u |||| |||||||||||||| ||| ||| | ||||| 3' uccu ccauuagauguagg ucc aau g uauau u u uca gu u gggg c a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR2111e |
|
Accession | MIMAT0023237 |
Sequence |
11 - uaaucugcauccugagguuua - 31 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|