Stem-loop sequence gma-MIR399f

AccessionMI0019786 (change log)
DescriptionGlycine max miR399f stem-loop
Gene family MIPF0000015; MIR399
Literature search

14 open access papers mention gma-MIR399f
(87 sentences)

Stem-loop
   u   u c   a a         cu           aucaagaagcuauuaaug 
5'  ggg g auu c gggcaaguu  cuuuggcaggu                  c
    ||| | ||| | |||||||||  |||||||||||                  u
3'  ucc c uaa g cccguuuag  gaaaccgucca                  a
   -   u u   c a         ag           acgugugcaugugaacau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 9110335-9110442 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR399f
gma-MIR399gchr8: 9118325-9118459 [-]
gma-MIR399fchr8: 9110335-9110442 [-]
gma-MIR399kchr8: 9106143-9106243 [+]
Database links

Mature sequence gma-miR399f

Accession MIMAT0023241
Sequence

78 - 

ugccaaaggagauuugcccag

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).