Stem-loop sequence gma-MIR399g

AccessionMI0019787 (change log)
DescriptionGlycine max miR399g stem-loop
Gene family MIPF0000015; MIR399
Literature search

14 open access papers mention gma-MIR399g
(87 sentences)

Stem-loop
   guguggaucuucccaguugcagcuguauuaca        u    a         a  -c    u  --ua    ucu 
5'                                 gggcaagu cucc uuggcaggu gc  acua ga    ugca   c
                                   |||||||| |||| ||||||||| ||  |||| ||    ||||   a
3'                                 cccguuua gagg aaccgucua cg  ugau cu    acgu   u
   --------------------uccucuuagcga        -    a         a  ua    u  uuca    uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 9118325-9118459 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR399g
gma-MIR399gchr8: 9118325-9118459 [-]
gma-MIR399fchr8: 9110335-9110442 [-]
Database links

Mature sequence gma-miR399g

Accession MIMAT0023242
Sequence

105 - 

ugccaaaggagauuugcccag

 - 125

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).