Stem-loop sequence gma-MIR5674b

AccessionMI0019793 (change log)
DescriptionGlycine max miR5674b stem-loop
Gene family MIPF0001447; MIR5674
Literature search

2 open access papers mention gma-MIR5674b
(2 sentences)

Stem-loop
   c    gg  -       uuu          ucauuuaagaaguuaguugcuucuuucagcuuaccaacaaugaagccacacaaucaagaauuacaaguggca 
5'  acuu  gu ugaugau   caauacgauu                                                                        a
    ||||  || |||||||   ||||||||||                                                                         
3'  ugag  ua acuauua   guuguguuaa                                                                        c
   c    au  c       cau          uaacugaaauacauuuguauuugaacauaccaaaaaaaaggauuuuaccaacaguuucccuaaaaacaauua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 40101457-40101661 [+]
intergenic
Database links

Mature sequence gma-miR5674b

Accession MIMAT0023248
Sequence

175 - 

uaauuguguuguacauuauca

 - 195

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).