Stem-loop sequence hco-mir-5885a

AccessionMI0019995 (change log)
DescriptionHaemonchus contortus miR-5885a stem-loop
Gene family MIPF0001404; mir-5885
Literature search

1 open access papers mention hco-mir-5885a
(2 sentences)

Stem-loop
   ----gcgcucggucggcaccgauaaca           g      g         
5'                            ggguguacgug uggucu guaagugu 
                              ||||||||||| |||||| ||||||| g
3'                            cuuauaugcgc acuaga uauucgcu 
   gcagcuguccgcagcuugaacgcgccg           -      g         
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5885a

Accession MIMAT0023319
Sequence

59 - 

ugagaucacgcguauauucgc

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).