Stem-loop sequence hco-mir-40b

AccessionMI0019999 (change log)
DescriptionHaemonchus contortus miR-40b stem-loop
Literature search

1 open access papers mention hco-mir-40b
(1 sentences)

Stem-loop
   ------guc      aucuc     -          --     gu  u     - gu 
5'          ggccgc     cagcg guccgcuaca  auacc  cg ugaag c  u
            ||||||     ||||| ||||||||||  |||||  || ||||| |  c
3'          uuggcg     gucgu caggcgaugu  ugugg  gc acuuc g  a
   gucaccaua      ----a     a          uc     --  c     u gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-40b

Accession MIMAT0023323
Sequence

57 - 

ucaccgggugucuuguagcgga

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).