Stem-loop sequence hco-mir-61

AccessionMI0020011 (change log)
DescriptionHaemonchus contortus miR-61 stem-loop
Literature search

1 open access papers mention hco-mir-61
(7 sentences)

Stem-loop
   uu   uuccugc  u  uc    u    a  c         ugg      c  -  u 
5'   gug       ug gc  cugc cacu ac ccgggugac   cugguc ug gc a
     |||       || ||  |||| |||| || |||||||||   |||||| || ||  
3'   cgc       ac cg  gacg gugg ug ggcucauug   gaucag ac cg c
   -c   --uguaa  u  -u    -    g  c         uca      u  u  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-61

Accession MIMAT0023335
Sequence

65 - 

ugacuagacuguuacucggcgu

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).