Stem-loop sequence hco-mir-5895

AccessionMI0020013 (change log)
DescriptionHaemonchus contortus miR-5895 stem-loop
Literature search

1 open access papers mention hco-mir-5895
(11 sentences)

Stem-loop
   ----    accu    a  uc a  c           uc         - a 
5'     ccaa    gccg gg  u gg uacccguagca  uguaugucu c a
       ||||    |||| ||  | || |||||||||||  ||||||||| | u
3'     gguu    uggc cc  a cc gugggugucgu  acguauaga g u
   gcca    -auu    -  ga a  a           uu         a u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5895

Accession MIMAT0023337
Sequence

23 - 

uacccguagcaucuguaugucu

 - 44

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).