Stem-loop sequence hco-mir-87a

AccessionMI0020022 (change log)
DescriptionHaemonchus contortus miR-87a stem-loop
Gene family MIPF0000152; mir-87
Literature search

1 open access papers mention hco-mir-87a
(1 sentences)

Stem-loop
   -------ccauga     c    u     -        c    c u    a   -  au 
5'              augag uccg cucgc cgccugaa cuuu g cuca ccu cu  g
                ||||| |||| ||||| |||||||| |||| | |||| ||| ||   
3'              ugcuc aggc gagcg guggacuu gaaa c gagu gga gg  c
   ccguugccucaua     -    -     u        u    - -    -   c  gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-87a

Accession MIMAT0023347
Sequence

60 - 

gugagcaaaguuucaggugugc

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).