Stem-loop sequence hco-mir-83

AccessionMI0020029 (change log)
DescriptionHaemonchus contortus miR-83 stem-loop
Gene family MIPF0000251; mir-83
Literature search

1 open access papers mention hco-mir-83
(1 sentences)

Stem-loop
   ----c  ucuauu       gau   c          u  c a      caa g 
5'      cc      gaugagu   agu cugaauuuau ug g gcugga   u a
        ||      |||||||   ||| |||||||||| || | ||||||   |  
3'      gg      cugcucg   uua gacuuaaaug ac c cgaucu   a a
   ccuuu  uucacu       agu   c          u  - a      -ag a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-83

Accession MIMAT0023355
Sequence

59 - 

uagcaccauguaaauucagca

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).