Stem-loop sequence hco-mir-71

AccessionMI0020032 (change log)
DescriptionHaemonchus contortus miR-71 stem-loop
Gene family MIPF0000278; mir-71
Literature search

2 open access papers mention hco-mir-71
(5 sentences)

Stem-loop
   ugccagccggu     gagagag    -  ua    u              u         g   -  uu 
5'            gcaug       ugcg ag  guuc gagggugaaagaca ggguaguga acg cu  g
              |||||       |||| ||  |||| |||||||||||||| ||||||||| ||| ||  u
3'            cguau       acgc uc  uaag uucccgcuuuuugu cuuaucacu ugc gg  u
   ----------a     ------a    a  --    u              -         a   c  uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-71

Accession MIMAT0023358
Sequence

42 - 

ugaaagacauggguagugagac

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).