Stem-loop sequence hco-mir-5352

AccessionMI0020053 (change log)
DescriptionHaemonchus contortus miR-5352 stem-loop
Literature search

2 open access papers mention hco-mir-5352
(69 sentences)

Stem-loop
   ---ucaaau    -ccccaa          -     -    u        u   g 
5'          gucg       acccugcggg cgugc ucgu gugcagug guu u
            ||||       |||||||||| ||||| |||| |||||||| |||  
3'          cagu       ugggacgucc gcaug agua cacguuac uag c
   ccccaugcc    uccuaac          a     u    -        -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5352

Accession MIMAT0023381
Sequence

58 - 

uugcacaugauguacgaccugca

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).