Stem-loop sequence hco-mir-228

AccessionMI0020061 (change log)
DescriptionHaemonchus contortus miR-228 stem-loop
Gene family MIPF0000292; mir-228
Literature search

2 open access papers mention hco-mir-228
(2 sentences)

Stem-loop
   -  -  -au    aa    c  ug a  a  u       guu 
5'  gg ag   cccg  augg ac  c ug au cacgguu   g
    || ||   ||||  |||| ||  | || || |||||||    
3'  cc uc   gggc  uacc ug  g ac ua gugccgg   c
   g  g  gcu    ca    u  gu -  c  c       gcu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-228

Accession MIMAT0023389
Sequence

11 - 

aaauggcacugcaugaauucacgg

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).