Stem-loop sequence hco-mir-5885b

AccessionMI0020086 (change log)
DescriptionHaemonchus contortus miR-5885b stem-loop
Gene family MIPF0001404; mir-5885
Literature search

1 open access papers mention hco-mir-5885b
(1 sentences)

Stem-loop
   ----auc u   a   -ucc     -cca           g      g      a 
5'        g gaa cgg    guacg    ggguaugggug uggucu guaagc u
          | ||| |||    |||||    ||||||||||| |||||| |||||| g
3'        c cuu gcu    caugu    cuuauauccgc acuaga uauucg a
   aacccgu -   a   ugaa     uucg           -      g      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5885b

Accession MIMAT0023417
Sequence

59 - 

ugagaucacgccuauauucgc

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).