Stem-loop sequence hco-mir-60

AccessionMI0020136 (change log)
DescriptionHaemonchus contortus miR-60 stem-loop
Gene family MIPF0000298; mir-60
Literature search

1 open access papers mention hco-mir-60
(2 sentences)

Stem-loop
   ------ga      c    c    cc     ug    c   -     a   -     
5'         uggccg aacg uguu  ugagc  gaaa ugu cauaa auc cuuu 
           |||||| |||| ||||  |||||  |||| ||| ||||| ||| ||| c
3'         gccggc uugu acag  acuug  cuuu aca guauu uag gagu 
   gacaccca      -    -    -a     gu    u   c     a   c     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-60

Accession MIMAT0023468
Sequence

57 - 

uauuaugcacauuuucugguucaa

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).