Stem-loop sequence hco-mir-5885c

AccessionMI0020152 (change log)
DescriptionHaemonchus contortus miR-5885c stem-loop
Gene family MIPF0001404; mir-5885
Literature search

1 open access papers mention hco-mir-5885c
(1 sentences)

Stem-loop
   ----guccgccaauaaacggcugauuauca           g  u   g      a 
5'                               gaguauacgug ug ucu guaagc u
                                 ||||||||||| || ||| |||||| g
3'                               cuuauaugcgc ac aga uauucg a
   ugaggggagcuccuaagcuugaacagaucg           -  u   g      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5885c

Accession MIMAT0023484
Sequence

62 - 

ugagaucacgcguauauucgcua

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).